@ARTICLE{TreeBASE2Ref18757,
author = {Eric J. Tepe and Lynn Bohs},
title = {A molecular phylogeny of Solanum sect. Pteroidea (Solanaceae) and the utility of COSII markers in resolving relationships among closely related species.},
year = {2010},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Taxon},
volume = {},
number = {},
pages = {},
abstract = {Solanum section Pteroidea is a lineage of ten species of Neotropical herbs and vines with a center of distribution in the eastern Andean slopes. It is a member of the informally named Potato clade of Solanum, a group that includes the potato (S. tuberosum) and tomato (S. lycopersicum). Members of Solanum sect. Pteroidea are characterized by inflorescences that emerge from the leaf axils and rugose, sharply pointed fruits in most species. The aim of this study is to infer phylogenetic relationships among sixteen species of Solanum, including all ten species of sect. Pteroidea, using DNA sequence data from the chloroplast trnT--trnF and five nuclear regions: ITS, the granule bound starch synthase gene (GBSSI or waxy), and three Conserved Orthologous Set II (COSII) markers. Results provide strong support for the monophyly of sect. Pteroidea and for its sister group relationship to sect. Herpystichum. Solanum mite, one of the most widespread and morphologically variable species in the section, is not monophyletic. The COSII markers ranged in length from 414--1666 bp with intronic content between 66--91%, and the three COSII markers together had more parsimony-informative characters than the three more commonly used markers combined. Bayesian analyses using a total evidence concatenated approach and a coalescent approach implemented in BEST (Bayesian Estimation of Species Trees) produced largely congruent topologies. The total evidence trees, however, were much more highly-supported than the BEST trees. Although not useful individually in sect. Pteroidea, the three COSII markers were easy to amplify, provided clean sequences, and were tremendously useful in increasing resolution and support among the closely related species of sect. Pteroidea in combined analyses.}
}
Matrix 4909 of Study 10267

Citation title:
"A molecular phylogeny of Solanum sect. Pteroidea (Solanaceae) and the utility of COSII markers in resolving relationships among closely related species.".

This study was previously identified under the legacy study ID S2627
(Status: Published).
Matrices
Title: GBSSI
Description: Legacy TreeBASE Matrix ID = M5031
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Solanum anceps 2790a |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum anceps 3626 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum anceps 2376 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum anceps 2600 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum anceps 2608 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum anceps 2655 |
(none)
|
-------------------------GATAC |
Solanum angustialatum |
(none)
|
TTATGACCAATACAAAGATGCTTGGGATAC |
Solanum chamaepolybotryon |
(none)
|
------------------------------ |
Solanum conicum |
(none)
|
-----------------------------C |
Solanum incurvum 2294 |
(none)
|
------------------------------ |
Solanum incurvum 2301 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum mite 2750 |
(none)
|
-TATGACCAATACAAAGATGCGTGGGATAC |
Solanum mite 3014 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum mite 3627 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum mite 2364 |
(none)
|
-------------------------GATAC |
Solanum savanillense |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum ternatum 3395 |
(none)
|
TTATGATCAATACAAAGATGCGTGGGATAC |
Solanum ternatum 2320 |
(none)
|
----------------GATGCGTGGGATAC |
Solanum trizygum 3509 |
(none)
|
----------TACAAAGATGCGTGGGATAC |
Solanum trizygum 7678 |
(none)
|
-----------------------------C |
Solanum uleanum 2720 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum uleanum 3628 |
(none)
|
TTATGACCAATACAAAGATGCGTGGGATAC |
Solanum brevifolium |
(none)
|
-----------------------GGGATAC |
Solanum bulbocastanum |
(none)
|
TTATGACCAATACAAAGATGCTTGGGATAC |
Solanum caripense |
(none)
|
----------------------TGGGATAC |
Solanum evolvulifolium |
(none)
|
TTATGACCAATACAAAGATGCTTGGGATAC |
Solanum lycopersicum |
(none)
|
TTATGACCAATACAAAGATGCTTGGGATAC |
Solanum phaseoloides |
(none)
|
-------------------GCTTGGGATAC |
Columns
None of the columns has a description.