@ARTICLE{TreeBASE2Ref14516,
author = {Shane Ahyong and Joelle Lai and Deirdre Sharkey and Donald J Colgan and Peter K. L. Ng},
title = {Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA},
year = {2007},
keywords = {},
doi = {10.1016/j.ympev.2007.03.022},
url = {},
pmid = {},
journal = {Molecular Phylogenetics and Evolution},
volume = {45},
number = {2},
pages = {576--586},
abstract = {The true crabs, the Brachyura, are generally divided into two major groups, the Eubrachyura or advanced crabs, and the Podotremata or primitive crabs. The status of Podotremata is one of the most controversial issues in brachyuran systematics. The podotreme crabs, best recognized by their possession of gonopores on the coxae of the pereopods, have variously been regarded as mono-, para- or polyphyletic, or even as non-brachyuran. For the first time, the phylogenetic positions of the podotreme crabs were studied by cladistic analysis of small subunit nuclear ribosomal RNA sequences. Eight of 10 podotreme families were represented along with representatives of 17 eubrachyuran families. Under both maximum parsimony and Bayesian Inference, Podotremata was found to be significantly paraphyletic, comprising three major clades: Dromiacea, Raninoida, and Cyclodorippoida. The most basal is Dromiacea, followed by Raninoida and Cylodorippoida. Notably, Cyclodorippoida was identified as the sister group of the Eubrachyura. Previous hypotheses that the dromiid crab, Hypoconcha, is an anomuran were unsupported, though Dromiidae as presently composed could be paraphyletic. Topologies constrained for podotreme monophyly were found to be significantly worse (P<0.04) than unconstrained topologies under Shimodaira-Hasegawa tests. The clear pattern of podotreme paraphyly and robustness of topologies recovered indicates that Podotremata as a formal concept should be abandoned. Relationships among the eubrachyurans were generally equivocal, though results indicate the majoids or dorippoids were the least derived of the Eubrachyura.}
}
Matrix 7679 of Study 1784
Citation title:
"Phylogenetics of the brachyuran crabs (Crustacea: Decapoda): the status of Podotremata based on small subunit nuclear ribosomal RNA".
This study was previously identified under the legacy study ID S1756
(Status: Published).
Matrices
Title: Sordariomycete tubB
Description: beta-tubulin of of Periglandula gen. nov.
Rows
Taxon Label |
Row Segments |
Characters 1?–30 |
Xylaria atrosphaerica GQ495953 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
Isaria farinosa DQ079607 |
(none)
|
------------------------------ |
Beauveria bassiana AY366065 |
(none)
|
--------TACACTGAGGGTGCCGAGCTCG |
Chaetomidium subfimeti FJ666373 |
(none)
|
--------TACACCGAGGGTGCCGAGCTCG |
Annulohypoxylon elevatidiscus AY951656 |
(none)
|
--------TACACCGAGGGTGCCGAGCTTG |
Daldinia clavata AY951693 |
(none)
|
--------TACACTGAGGGTGCTGAGTTGG |
Hypoxylon duranii AY951714 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
Epichloe typhina X52616 |
(none)
|
--------TACACTGAGGGTGCTGAGCTGG |
Epichloe festucae AY722412 |
(none)
|
ATACGAACTACACTGAGGGTGCTGAGCTGG |
Periglandula turbinae TcorF01 HQ702604 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Periglandula ipomoeae IasaF13 HQ702605 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Periglandula ipomoeae IasaredF01 HQ702606 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Corallocytostroma ornithocopreoides FJ711475 |
(none)
|
--------TACACCGAAGGTGCTGAGCTGG |
Claviceps viridis EF473865 |
(none)
|
--------TACACTGAAGGTGCTGAGCTGG |
Claviceps purpurea FM987276 |
(none)
|
--------TACACTGAAGGTGCCGAGCTGG |
Columns
None of the columns has a description.