@ARTICLE{TreeBASE2Ref18714,
author = {Kristina Lehnert and Georg von Samson-Himmelstjerna and Dirk Schaudien and Christoph Bleidorn and Peter Wohlsein and Ursula Siebert},
title = {Transmission of lungworms of harbour porpoises and harbour seals: molecular tools determine potential vertebrate intermediate hosts.},
year = {2010},
keywords = {Lungworms; Metastrongyloidea; Intermediate hosts; Life cycle; Porpoises; Seals; Fish; Molecular tools},
doi = {10.1016/j.ijpara.2009.12.008},
url = {},
pmid = {},
journal = {International Journal for Parasitology},
volume = {},
number = {},
pages = {},
abstract = {Harbour porpoises (Phocoena phocoena) and harbour seals (Phoca vitulina) from German waters are infected by six species of lungworms (Metastrongyloidea). These nematodes parasitize the respiratory tract, are pathogenic and often cause secondary bacterial infections. In spite of their clinical and epidemiological significance, the life cycle and biology of lungworms in the marine environment is still largely unknown. Regions of ribosomal DNA (ITS-2) of all lungworms parasitizing harbour porpoises and harbour seals in German waters were sequenced to characterise and compare the different species. The phylogenetic relationship among the lungworm species was analysed by means of their ITS-2 nucleotide sequences and the species-specific traits of the ITS-2 were used to screen wild fish as possible intermediate hosts for larval lungworms. Molecular markers were developed to identify larval nematodes via in-situ hybridisation of tissues of harbour porpoise and harbour seal prey fish. Potential wild intermediate fish hosts from the North Sea were dissected and found to harbour larval nematodes. Histological examination and in-situ hybridisation of tissue samples from these fish showed lungworm larvae within the intestinal wall. Based on larval ITS-2 nucleotide sequences, larval nematodes were identified as Pseudalius inflexus and Parafilaroides gymnurus. Turbot (Psetta maxima) bred and raised in captivity were experimentally infected with live L1s of Otostrongylus circumlitus and ensheathed larvae were recovered from the gastrointestinal tract of turbot and identified using molecular tools. Our results show that fish intermediate hosts play a role in the transmission of metastrongyloid nematodes of harbour porpoises and harbour seals.}
}
Matrix 4926 of Study 10224

Citation title:
"Transmission of lungworms of harbour porpoises and harbour seals: molecular tools determine potential vertebrate intermediate hosts.".

This study was previously identified under the legacy study ID S2580
(Status: Published).
Matrices
Title: Figure 1
Description: Legacy TreeBASE Matrix ID = M4928
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Hovorkonema variegatum |
(none)
|
----------------------ACGTCTGG |
| Ostertagia ostertagi |
(none)
|
--CGTTGGGTTTTCCCTTCGGCACGTCTGG |
| Mecistocirrus digitatus |
(none)
|
GCCGTTGGGTTTTCCCTTCGGCACGTCTGG |
| Umingmakstrongylus pallikuukensis |
(none)
|
----------------------ACGTCTGG |
| Metastrongylus elongatus |
(none)
|
-------------------------TCTGG |
| Metastrongylus salmi |
(none)
|
----------------------------GG |
| Metastrongylus pudendotectus |
(none)
|
--------------------------CTGG |
| Aelurostrongylus abstrusus |
(none)
|
----------------------ACGTCTGG |
| Varestrongylus alpenae |
(none)
|
----------------------ACGTCTGG |
| Heligmosomum mixtum |
(none)
|
GCCGTTGGGTTTTCCCTTCGGCACGTCTGG |
| Otostrongylus circumlitus |
(none)
|
GTCGTTGGGATTTCCCTTCGGCACATCTGG |
| Parafilaroides gymnurus |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Pseudalius inflexus |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Stenurus minor |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Torynurus convolutus |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Stenurus globicephalae |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Halocercus invaginatus |
(none)
|
GTCGTTGGGTTTTCCCTTCGGCACATCTGG |
| Dictyocaulus filaria |
(none)
|
GCCGTTGGGTATTCCCTTCGGCACATCTGG |
Columns
None of the columns has a description.