@ARTICLE{TreeBASE2Ref19121,
author = {Sabine Fink and Martin C. Fischer and Laurent Excoffier and Gerald Heckel},
title = {Genomic Scans Support Repetitive Continental Colonization Events during the Rapid Radiation of Voles (Rodentia: Microtus): the Utility of AFLPs versus Mitochondrial and Nuclear Sequence Markers },
year = {2010},
keywords = {rodents, Arvicolinae, voles, AFLP, arginine-vasopressin receptor 1a, cytochrome b, phylogeny, colonization},
doi = {},
url = {http://},
pmid = {},
journal = {Systematic Biology},
volume = {},
number = {},
pages = {},
abstract = {Single locus studies might not resolve phylogenetic relationships and the evolutionary history of taxa. The analysis of multiple markers promises higher resolution, and congruence among loci may indicate that the phylogenies represent the underlying species history. Here we examine the utility of a genome-wide approach based on amplified fragment length polymorphisms (AFLP) and several DNA sequence markers in resolving phylogenetic signals in the rapidly radiating rodent genus Microtus which produced about 70 vole species within the last 1.2 to 2 million years. The current Holarctic distribution of Microtus is assumed to have resulted from three independent colonization events out of Asia to North America, Europe, and northern Asia without subsequent colonization, which would have led to deep splits between species from different continents. We investigated this hypothesis of three single colonization events by reconstructing the phylogenetic relationships among species from all three continents based on data from the first exon of the nuclear arginine vasopressin receptor 1a gene (EXON1), an adjacent non-coding region and the mitochondrial cytochrome b gene. The phylogenetic patterns obtained from these sequence markers are contrasted to genome-wide data on more than 1,800 amplified fragment length polymorphisms (AFLP) analyzed for the same samples. Our results show that the single sequence markers partially resolve the phylogenetic relationships within Microtus, but with some incongruence mostly between EXON1 and the other loci. However, deeper nodes of the radiation are only weakly supported and neither the combination of the markers nor additional nuclear sequences improved the resolution significantly. AFLPs provided much stronger support for major continent-specific clades, and show also that reciprocal monophyly of American and European voles is incomplete. Our results demonstrate that Microtus voles colonized the American and European continents each repeatedly in several independent events on similar colonization routes during their radiation. More generally, this study supports the suitability of AFLPs as an alternative to sequence markers to resolve the evolutionary history of rapidly radiating taxa.}
}
Matrix 6287 of Study 10754

Citation title:
"Genomic Scans Support Repetitive Continental Colonization Events during the Rapid Radiation of Voles (Rodentia: Microtus): the Utility of AFLPs versus Mitochondrial and Nuclear Sequence Markers ".

Study name:
"Genomic Scans Support Repetitive Continental Colonization Events during the Rapid Radiation of Voles (Rodentia: Microtus): the Utility of AFLPs versus Mitochondrial and Nuclear Sequence Markers ".

This study is part of submission 10744
(Status: Published).
Matrices
Title: Fig2b_avpr1a_upstream
Description: one individual per species
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Microtus arvalis 01 EU |
(none)
|
?????????????????????????????? |
| Microtus agrestis 01 EU |
(none)
|
???????????????????????GGGCAAA |
| Microtus tatricus 01 01 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus tatricus 01 02 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus rossiaemeridionalis 01 EU |
(none)
|
?????????????????????????????? |
| Microtus multiplex 01 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus nivalis 01 01EU |
(none)
|
????GTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus nivalis 01 02 EU |
(none)
|
????GTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus felteni 01 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus thomasi 01 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus cabrerae 01 02 EU |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus socialis 01 EU |
(none)
|
?????????????????????????????? |
| Microtus oeconomus 01 HOL |
(none)
|
?????????????????????GCGGGCAAA |
| Microtus ochrogaster 01 01 NA |
(none)
|
??GGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus ochrogaster 01 02 NA |
(none)
|
??GGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus montanus 01 NA |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus pinetorum 01 01 NA |
(none)
|
GTAGGTGGGTCTTATCTGTTTGCGGGCAAA |
| Microtus pinetorum 01 02 NA |
(none)
|
GTAGGTGGGTCTTATCTGTTTGCGGGCAAA |
| Microtus californicus 01 01 NA |
(none)
|
GTAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus californicus 01 02 NA |
(none)
|
GTAGGTGGGTCTTGTCTGTTCGCGGGCAAA |
| Microtus chrotorrhinus 01 01 NA |
(none)
|
?TAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus chrotorrhinus 01 02 NA |
(none)
|
?TAGGTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus richardsoni 01 01 NA |
(none)
|
????GTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus richardsoni 01 02 NA |
(none)
|
????GTGGGTCTTATCTGTTCGCGGGCAAA |
| Microtus abbreviatus 01 NA |
(none)
|
?????????????????????????????? |
| Microtus oregoni 01 NA |
(none)
|
?????????????????????????????? |
| Microtus montebelli 01 AS |
(none)
|
GTAGGTGGGTCTGATCTGTTTGCAGGCAAA |
| Microtus kikuchii 01 AS |
(none)
|
?????????????????????????????? |
| Arvicola terrestris EU |
(none)
|
?????????????????????????????? |
| Microtus longicaudus 01 NA |
(none)
|
GTAGGTGGGTCTTATCTGTTCGC------- |
| Microtus schelkovnikovi 01 EU |
(none)
|
?????????????????????????????? |
| Microtus townsendii 01 NA |
(none)
|
?????????????????????????????? |
Columns
None of the columns has a description.