@ARTICLE{TreeBASE2Ref17904,
author = {Wendy A. Untereiner and J. A. Scott and Francoise A. Naveau and Lynne Sigler and Jason Bachewich and Andrea Angus},
title = {The Ajellomycetaceae, a new family of vertebrate-associated Onygenales.},
year = {2004},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {Phylogenies inferred from the analysis of DNA sequence data have shown that the Onygenales contains clades that do not correspond with previously described families. One lineage identified in recent molecular phylogenetic studies includes the dimorphic pathogens belonging to the genera Ajellomyces, Emmonsia and Paracoccidioides. To evaluate the degree of support for this lineage and determine whether it includes additional taxa, we examined relationships among the members of this clade and selected saprobic onygenalean taxa based on maximum parsimony analyses of partial nuclear large RNA subunit (LSU) and internal transcribed spacer (ITS) sequences. A clade distinct from the Onygenaceae was found to encompass Ajellomyces (including the anamorph genera Blastomyces, Emmonsia and Histoplasma) and Paracoccidioides brasiliensis. The members of this lineage are saprobic and pathogenic vertebrate-associated taxa distinguished by their globose ascomata with coiled appendages, muricate globose or oblate ascospores, and lack of keratinolytic activity. Anamorphs are solitary aleurioconidia or irregular alternate arthroconidia. Based on molecular data and on morphological and physiological similarities among these taxa, we propose the new family, Ajellomycetaceae.}
}
Matrix 2423 of Study 1140

Citation title:
"The Ajellomycetaceae, a new family of vertebrate-associated Onygenales.".

This study was previously identified under the legacy study ID S1047
(Status: Published).
Matrices
Title: ITS - 28S
Description: Legacy TreeBASE Matrix ID = M1785
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Spiromastix warcupii |
(none)
|
GGATCATTACCGTGCCTGTAGTT------- |
| Spiromastix tentaculatum |
(none)
|
GGATCATTAACGTGCCC------------- |
| Polytolypa hystricis |
(none)
|
GGATCATTACCGTGCC-------------- |
| Paracoccidioides brasiliensis |
(none)
|
GGATCATTAACGCGCC-------------- |
| Emmonsia sp UAMH7425 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Emmonsia sp UAMH2304 |
(none)
|
GGATCATTAACGTGCCC------------- |
| Emmonsia sp UAMH141 |
(none)
|
GGATCATTAACGTGCCC------------- |
| Emmonsia parva UAMH6312 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Emmonsia parva UAMH130 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Auxarthron californiense |
(none)
|
GGATCATTAAAGTGTTTCTTGCTGCGGCGC |
| Aphanoascus fulvescens |
(none)
|
GGATCATTAAAGTGTTTCGGAGCCTGGC-- |
| Amauroascus aureus |
(none)
|
GGATCATTACAGTGCCTTCTGACCTGCGTC |
| Ajellomyces grisea |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces dermatitidis UAMH5438 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces dermatitidis ATCC18187 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces crescens UAMH4077 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces crescens UAMH394 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces crescens UAMH349 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces crescens UAMH137 |
(none)
|
GGATCATTAACGCGCC-------------- |
| Ajellomyces capsulatus UAMH7141 |
(none)
|
GGATCATTACCACGCC-------------- |
| Ajellomyces capsulatus UAMH3536 |
(none)
|
GGATCATTACCACGCC-------------- |
Columns
None of the columns has a description.