@ARTICLE{TreeBASE2Ref16598,
author = {Patrick Brandon Matheny and Neale L. Bougher},
title = {The new genus Auritella from Africa and Australia (Inocybaceae, Agaricales): molecular systematics, taxonomy and historical biogeography},
year = {2005},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Mycological Progress},
volume = {},
number = {},
pages = {},
abstract = {Recent phylogenetic evidence strongly supports a monophyletic group of Afro-Australian agaricoid and sequestrate species with phenotypic affinities to the genus Inocybe (Agaricales, Basidiomycota). Here this clade is proposed as the new genus Auritella. Seven species are fully documented with taxonomic descriptions and illustrations, four of which are described as new. A key to genera and major clades of the Inocybaceae and a key to species of Auritella are provided. A maximum likelihood tree using rpb2 and nLSU-rDNA nucleotide sequences depicts the phylogenetic relationships of five of the seven species of the genus, of which the Australian taxa form a monophyletic group. An ancient split between Australian and African lineages is hypothesized using a molecular clock that dates back at least to the late Cretaceous (about 86 Ma). Diversification of Australian species of Auritella is estimated to have first occurred in the early Tertiary (about 60 Ma).}
}
Matrix 1563 of Study 1390

Citation title:
"The new genus Auritella from Africa and Australia (Inocybaceae, Agaricales): molecular systematics, taxonomy and historical biogeography".

This study was previously identified under the legacy study ID S1360
(Status: Published).
Matrices
Title: Auritella-11
Description: Legacy TreeBASE Matrix ID = M2410
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Inocybe terrigena |
(none)
|
GAGTGAAGCGGGAAAAGCTCAAATTTAAAA |
| Auritella serpentinocystis |
(none)
|
GAGTGAAGTGGGAAGAGCTCAAATTTAAAA |
| Auritella geoaustralis |
(none)
|
------------------------------ |
| Auritella dolichocystis T24844 |
(none)
|
GAGTGAAGTGGGAAAAGCTCAAATTTAAAA |
| Auritella dolichocystis T24843 |
(none)
|
GAGTGAAGTGGGAAAAGCTCAAATTTAAAA |
| Auritella dolichocystis T24838 |
(none)
|
GAGTGAAGTGGGAAAAGCTCAAATTTAAAA |
| Auritella chamaecephala |
(none)
|
GAGTGAAGTGGGAAAAGCTCAAATTTAAAA |
| Auritella aureoplumosa |
(none)
|
GAGTGAAGTGGGAAGAGCTCAAATTTAAAA |
| Crepidotus versutus |
(none)
|
GAGTGAAGCGGGAAAAGCTCAAATTTGAAA |
| Crepidotus cf applanatus |
(none)
|
GAGTGAAGCGGGAAAAGCTCAAATTTAAAA |
| Inocybe unicolor |
(none)
|
GAGTGAAGCGGGAAAAGCTCAAATTTAAAA |
Columns
None of the columns has a description.