@ARTICLE{TreeBASE2Ref21832,
author = {Matthew Allen Campbell and Martijn Staats and J.A.L. van Kan and Antonis Rokas and Jason C. Slot},
title = {Repeated loss of an anciently horizontally transferred gene cluster in Botrytis.},
year = {2013},
keywords = {Genome evolution, plant pathogens, rewiring, secondary metabolism},
doi = {},
url = {http://},
pmid = {},
journal = {Mycologia},
volume = {},
number = {},
pages = {},
abstract = {At least five of the six genes of the bikaverin secondary metabolic gene cluster were previously shown to have undergone horizontal transfer (HGT) from a Fusarium donor to the Botrytis lineage. Of these five genes, two enzyme-encoding genes are found as pseudogenes in B. cinerea, whereas two regulatory genes and the transporter remain intact. To reconstruct the evolutionary events leading to decay of this gene cluster and infer a more precise timing of its transfer, we examined the genomes of nine additional broadly sampled Botrytis species. We found evidence that a Botrytis ancestor acquired the entire gene cluster through an ancient HGT that occurred prior to the diversification of the genus. During the subsequent evolution and diversification of the genus, four of the ten genomes appear to have lost the entire gene cluster, while in the other six the cluster is in various stages of degeneration. Across the Botrytis genomes, the modes of gene decay in the cluster differed between enzyme-encoding genes, which had higher rates of transition to or retention of pseudogenes and were universally inactivated, and regulatory genes (particularly the non-pathway-specific regulator bik4), which more frequently appeared intact. Consistent with these results, the regulatory genes bik4 and bik5 showed stronger evidence of transcriptional expression than other bikaverin genes under multiple conditions in B. cinerea. These results could be explained by pleiotropy in the bikaverin regulatory genes either through rewiring or their interaction with more central pathways, or by constraints on the order of gene loss driven by the intrinsic toxicity of the pathway. Our finding that most of the bikaverin pathway genes have been lost or pseudogenized in these Botrytis genomes suggests that the incidence of HGT of gene cluster-encoded metabolic pathways might be higher than what is possible to be inferred from isolated genome analyses.}
}
Matrix 16361 of Study 14010

Citation title:
"Repeated loss of an anciently horizontally transferred gene cluster in Botrytis.".

Study name:
"Repeated loss of an anciently horizontally transferred gene cluster in Botrytis.".

This study is part of submission 14010
(Status: Published).
Matrices
Title: bik6_matrix
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Fusarium fujikuroi |
(none)
|
ATGAACGAACCCGCGGAAGAGTCCAACATG |
| Fusarium verticillioides |
(none)
|
ATGAGCGAA---------CAGTTCAACATG |
| Fusarium oxysporum |
(none)
|
ATGAACGAA---------GAGTCCAACATG |
| Botrytis tulipae |
(none)
|
ATGAACGAAACCGCGGAAGATTCCAACATG |
| Botrytis elliptica |
(none)
|
ATGAACGAAACCGCGGAAGAGTC-AACATG |
| Botrytis hyacinthi |
(none)
|
ATGAACGAACCCACGGAAGAGTCCAACATG |
| Botrytis cinerea T4 |
(none)
|
ATGAACGAACCCGCGGATGAGTTCAACATG |
| Botrytis cinerea B05.10 |
(none)
|
ATGAACGAACCCGCGGAAGAGTCCAACATG |
| Aspergillus carbonarius |
(none)
|
---------------ATGTCTCAACCCCAC |
Columns
None of the columns has a description.