@ARTICLE{TreeBASE2Ref23372,
author = {Hui Huang and Chao Shi and Yuan Liu and Shu Yan Mao and Li Zhi Gao},
title = {Thirteen Camellia chloroplast genome sequences determined by high-throughput sequencing: genome structure and phylogenetic relationships},
year = {2014},
keywords = {Camellia, Chloroplast genome, Phylogenetic relationships, Genomic structure, Taxonomic identification},
doi = {},
url = {http://},
pmid = {},
journal = {BMC Evolutionary Biology},
volume = {},
number = {},
pages = {},
abstract = {Camellia is an economically and phylogenetically important genus in the family Theaceae. Owing to numerous hybridization and polyploidization, it is taxonomically and phylogenetically ranked as one of the most challengingly difficult taxa in plants. Sequence comparisons of chloroplast (cp) genomes are of great interest to provide a robust evidence for taxonomic studies, species identification and understanding mechanisms that underlie the evolution of the Camellia species.
The eight complete cp genomes and five draft cp genome sequences of Camellia species were determined using Illumina sequencing technology via a combined strategy of de novo and reference-guided assembly. The Camellia cp genomes exhibited typical circular structure that was rather conserved in genomic structure and the synteny of gene order. Differences of repeat sequences, simple sequence repeats, indels and substitutions were further examined among five complete cp genomes, representing a wide phylogenetic diversity in the genus. A total of fifteen molecular markers were identified with more than 1.5 % sequence divergence that may be useful for further phylogenetic analysis and species identification of Camellia. Our results showed that, rather than functional constrains, it is the regional constraints that strongly affect sequence evolution of the cp genomes. In a substantial improvement over prior studies, evolutionary relationships of the section Thea were determined on basis of phylogenomic analyses of cp genome sequences. Despite a high degree of conservation between the Camellia cp genomes, sequence variation among species could still be detected, representing a wide phylogenetic diversity in the genus. Furthermore, phylogenomic analysis was conducted using 18 complete cp genomes and 5 draft cp genome sequences of Camellia species. Our results support Chang?s taxonomical treatment that C. pubicosta may be classified into sect. Thea, showing that taxonomical value of the number of ovaries should be reconsidered when classifying the Camellia species. The availability of these cp genomes provides valuable genetic information for accurately identifying species, clarifying taxonomy and reconstructing the phylogeny of the genus Camellia.
}
}
Matrix 23070 of Study 16027

Citation title:
"Thirteen Camellia chloroplast genome sequences determined by high-throughput sequencing: genome structure and phylogenetic relationships".

Study name:
"Thirteen Camellia chloroplast genome sequences determined by high-throughput sequencing: genome structure and phylogenetic relationships".

This study is part of submission 16027
(Status: Published).
Matrices
Title: Section Thea 14x67210
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Camellia grandibracteata |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia sinensis var. assamica |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia pubicosta |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia sinensis var. dehungensis |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia leptophylla |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia sinensis var. sinensis |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia sinensis var. pubilimba |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia reticulata |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia ptilophylla |
(none)
|
GGGCGAACGACGGGGATTGAACCCGCGCGT |
| Camellia fangchengensis |
(none)
|
GGGCGAACGACGGGGATTGAACCCGCGCGT |
| Camellia taliensis7 |
(none)
|
GGGCGAACGACGGGAATTGAACCCGCGCAT |
| Camellia kwangsiensis |
(none)
|
GGGCGAACGACGGGGATTGAACCCGCGCGT |
| Camellia crassicolumna var. crassicolumna |
(none)
|
GGGCGAACGACGGGGATTGAACCCGCGCGT |
| Camellia tachangensis |
(none)
|
----------------------CCGCGCGC |
Columns
None of the columns has a description.