@ARTICLE{TreeBASE2Ref25159,
author = {Fernando Hayashi Sant'Anna and Adriana Ambrosini and Rocheli Souza and Gabriela C Fernandes and Evelise Bach and Eduardo Balsanelli and Valter A Baura and Luciana F. Brito and Volker F. Wendisch and F?bio O Pedrosa and Emanuel M Souza and Luciane MP Passaglia},
title = {Reclassification of Paenibacillus riograndensis as a genomovar of Paenibacillus sonchi: genome-based metrics improve bacterial taxonomic classification },
year = {2017},
keywords = {paenibacillus; riograndensis; sonchi; graminis; jilunlii; taxonomy; ANI; phylogeny},
doi = {10.3389/fmicb.2017.01849 },
url = {http://journal.frontiersin.org/article/10.3389/fmicb.2017.01849/},
pmid = {},
journal = {Frontiers in Microbiology},
volume = {8},
number = {1849},
pages = {},
abstract = {Species from the genus Paenibacillus are widely studied due to their biotechnological relevance. Dozens of novel species descriptions of this genus were published in the last couple of years, but few utilized genomic data as classification criteria. Here we demonstrate the importance of using genome-based metrics and phylogenetic analyses to identify and classify Paenibacillus strains. For this purpose, Paenibacillus riograndensis SBR5T, Paenibacillus sonchi X19-5T, and their close relatives were compared through phenotypic, genotypic and genomic approaches. With respect to P. sonchi X19-5T, P. riograndensis SBR5T, Paenibacillus sp. CAR114, and Paenibacillus sp. CAS34 presented ANI (average nucleotide identity) values ranging from 95.61% to 96.32%, gANI (whole-genome average nucleotide identity) values ranging from 96.78% to 97.31%, and dDDH (digital DNA-DNA hybridization) values ranging from 68.2% to 73.2%. Phylogenetic analyses of 16S rRNA, gyrB, recA, recN, and rpoB genes and concatenated proteins supported the monophyletic origin of these Paenibacillus strains. Therefore, we propose to assign Paenibacillus sp. CAR114 and Paenibacillus sp. CAS34 to P. sonchi species, and reclassify P. riograndensis SBR5T as a later heterotypic synonym of P. sonchi (type strain X19-5T), with the creation of three novel genomovars, Paenibacillus sonchi genomovar Sonchi (type strain X19-5T), Paenibacillus sonchi genomovar Riograndensis (type strain SBR5T), Paenibacillus sonchi genomovar Oryzarum (type strain CAS34T = DSM 102041T; = BR10511T). }
}
Matrix 39516 of Study 18337

Citation title:
"Reclassification of Paenibacillus riograndensis as a genomovar of Paenibacillus sonchi: genome-based metrics improve bacterial taxonomic classification ".

Study name:
"Reclassification of Paenibacillus riograndensis as a genomovar of Paenibacillus sonchi: genome-based metrics improve bacterial taxonomic classification ".

This study is part of submission 18337
(Status: Published).
Matrices
Title: Paenibacillus gyrB gene alignment
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Paenibacillus polymyxa ATCC 842 515241126 |
(none)
|
ATGTCTATGAATCAACCGTCTTATGATGCG |
| Paenibacillus stellifer 740907564 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus sabinae T27 644566509 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus forsythiae T98 647252870 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus durus 754843085 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus durus ATCC 35681 647243955 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus zanthoxyli JH29 647240239 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus odorifer 738786454 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus wynnii 738758182 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus borealis 754849053 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus sp. HW567 655083021 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus sp. CAR114 AMQ83 15570 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus sp. CAS34 AMQ84 06735 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus riograndensis SBR5 PRIO 0006 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus sonchi X19 5 748214336 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus graminis 686555526 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
| Paenibacillus jilunlii AML91 23150 |
(none)
|
ATGTCAATGAATCAACCGACATATGATGAG |
Columns
None of the columns has a description.