@ARTICLE{TreeBASE2Ref15746,
author = {John Harshman and Edward L. Braun and Michael J. Braun and Christopher J. Huddleston and R. C. K. Bowie and Jena L. Chojnowski and Shannon J. Hackett and K. L. Han and Rebecca T. Kimball and Ben D. Marks and Kathleen J. Miglia and William S. Moore and Sushma Reddy and Frederick H. Sheldon and David W. Steadman and Scott J. Steppan and Christopher C Witt and Tamaki Yuri},
title = {Phylogenomic evidence for multiple losses of flight in ratite birds},
year = {2008},
keywords = {},
doi = {},
url = {},
pmid = {},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {},
number = {},
pages = {},
abstract = {Ratites (ostriches, emus, rheas, cassowaries, and kiwis) are large, flightless birds that have long fascinated biologists. Their current distribution on isolated southern land masses is believed to reflect the breakup of the paleocontinent of Gondwana. The prevailing view is that ratites are monophyletic, with the flighted tinamous as their sister group, suggesting a single loss of flight in the common ancestry of ratites. However, phylogenetic analyses of 20 unlinked nuclear genes reveal a genome-wide signal that unequivocally places tinamous within ratites, making ratites polyphyletic and suggesting multiple losses of flight. Phenomena that can mislead phylogenetic analyses, including long branch attraction, base compositional bias, discordance between gene trees and species trees, and sequence alignment errors, have been eliminated as explanations for this result. The most plausible hypothesis requires at least three losses of flight and explains the many morphological and behavioral similarities among ratites by parallel or convergent evolution. Finally, this phylogeny demands fundamental reconsideration of proposals that relate ratite evolution to continental drift.}
}
Matrix 3552 of Study 2134

Citation title:
"Phylogenomic evidence for multiple losses of flight in ratite birds".

This study was previously identified under the legacy study ID S2138
(Status: Published).
Matrices
Title: Paleognath nuclear genes 2
Description: Legacy TreeBASE Matrix ID = M4045
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Alligator mississippiensis |
(none)
|
?????????????????????????????? |
| Gavialis gangeticus |
(none)
|
?????????????????????????????? |
| Apteryx australis |
(none)
|
AAAGTTTGCTGCCAAGGGTGAGGCCCAACT |
| Casuarius casuarius |
(none)
|
GAAGTTCGCTGCCAAGGGTGAGGCCCAACT |
| Dromaius novaehollandiae |
(none)
|
AAAGTTCGCTGCCAAGGGTGAGGCCCAACT |
| Rhea americana |
(none)
|
AAAGTTTGCTGCCAAGGGTGAGGCCCAACT |
| Pterocnemia pennata |
(none)
|
?????????????????????????????? |
| Struthio camelus |
(none)
|
AAAGTTCGCTGCCAAGGGTGAGGCCCAACT |
| Crypturellus soui |
(none)
|
?????????????????????????????? |
| Eudromia elegans |
(none)
|
AAAGTTCGCTGCCAAGGGTGAGGCTCAGCT |
| Nothoprocta perdicaria |
(none)
|
AAAGTTTGCTGCCAAGGGTGAGGCTCAGCT |
| Tinamus guttatus |
(none)
|
AAAGTTTGCTGCCAAGGGTGAGGCTCAGCT |
| Anas platyrhynchos |
(none)
|
AAAGTTTGCTGCCAAGGGTGACGCCCAGCT |
| Gallus gallus |
(none)
|
AAAGTTTGCTGCCAAGGGTGATGCCCAGAT |
| Buteo jamaicensis |
(none)
|
AAAGTTCGCTGCCAAGGGTGATGCCCAGCT |
| Ciconia ciconia |
(none)
|
AAAGTTCGCTGCCAAGGGTGATGCCCAGCT |
| Corvus corone |
(none)
|
AAAGTTTGCTGCCAAGGGAGATGCCCAGCT |
| Smithornis rufolateralis |
(none)
|
AAAGTTTGCTGCCAAGGGAGATGCCCAGCT |
Columns
None of the columns has a description.