@ARTICLE{TreeBASE2Ref29237,
author = {Lei Feng and Na Li and Wei Yang and Chun-Ming Wang and Yan Li and Iris Tong and Jun-Xian He},
title = {Analyses of mitochondrial genomes of the genus Ammopiptanthus provide new insights into the evolution of legume plants},
year = {2019},
keywords = {Ammopiptanthus mongolicus; Ammopiptanthus nanus; Legume evolution; mitochondrial genome},
doi = {10.1007/s00606-019-01578-2},
url = {http://},
pmid = {},
journal = {Plant Systematics and Evolution},
volume = {305},
number = {5},
pages = {385--399},
abstract = {The plant Ammopiptanthus is a genus mainly distribute in the semi-arid regions of Northwest China. This genus belongs to the Leguminosae family and only contain two species, A. mongolicus and A. nanus. The two species exhibit similar morphological characteristics, but little is known about their genetic differences. We performed de novo assembly for their mitochondrial genomes and found both contain 36 protein-coding genes, 3 rRNA, and 16 tRNA genes. Comparison between A. mongolicus and A. nanus mitogenomes revealed a 6.5-kb region loss in A. nanus mitogenome, which was replaced by a 1.5-kb segment with a different sequence. Other small variations between them include 25 SNPs, 4 deletions and 2 insertions. Meta-analyses indicated 66.0% similarity of A. mongolicus mitogenome to other closely-related legume mitogenomes; the remaining 34.0% unique sequences are mainly distributed in intergenic regions. Gene gain and loss analysis showed that this mitogenome gained two genes, rps7 and sdh4, during evolution, with the rps7 transferred from the chloroplast genome. Selective pressure analysis implied that the atp8 gene was under positive selection. Our study established high-quality reference mitogenomes for the genus Ammopiptanthus, revealed novel genetic differences between A. mongolicus and A. nanus, and provided new insights into the evolution of legume plants.}
}
Matrix 50086 of Study 23902

Citation title:
"Analyses of mitochondrial genomes of the genus Ammopiptanthus provide new insights into the evolution of legume plants".

Study name:
"Analyses of mitochondrial genomes of the genus Ammopiptanthus provide new insights into the evolution of legume plants".

This study is part of submission 23902
(Status: Published).
Matrices
Title: Ammopiptanthus
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Ammopiptanthus mongolicus |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Ammopiptanthus nanus |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Lotus japonicus |
(none)
|
ATGGTAACTATTCGTGCAGATGAAATTAGT |
| Medicago truncatula |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Millettia pinnata |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Nicotiana tabacum |
(none)
|
ATGGTAACCATTCGAGCTGACGAAATTAGT |
| Vicia faba |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Vigna angularis |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Vigna radiata |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
| Glycine max |
(none)
|
ATGGTAACCATTCGTGCAGATGAAATTAGT |
Columns
None of the columns has a description.