@ARTICLE{TreeBASE2Ref18128,
author = {N. Wikstrm and P. Kenrick},
title = {Relationships of Lycopodium and Lycopodiella based on combined plastid rbcL gene and trnL intron sequence data.},
year = {2000},
keywords = {},
doi = {10.2307/2666692},
url = {},
pmid = {},
journal = {Systematic Botany},
volume = {25},
number = {3},
pages = {495--510},
abstract = {The relationships of Lycopodium and Lycopodiella (Lycopodiaceae) were investigated based on two plastid data sets (rbcL gene and trnL intron) from a representative sample of 21 species. Separate and combined analyses of the data reveal consistent patterns of relationship. There is strong support for monophyly of Lycopodium and Lycopodiella. There is also support for monophyly of species groups or sections sensu ?llgaard (Lycopodium, Diphasium, Magellanica, Complanata, Lycopodiella and Campylostachys). The combined data provide new evidence of relationships between subgeneric groups. In Lycopodium, section Pseudodiphasium groups with section Magellanica, section Obscura groups with section Diphasium, and section Annotina groups with section Lycopodium. In Lycopodiella, sections Lateristachys and Caroliniana group with section Campylostachys and this group is sister to section Lycopodiella. Tentative calibration of the phylogenetic tree using fossil evidence indicates a minimum age of Early Jurassic (208 Myr) for the split between Lycopodium and Lycopodiella. Reticulate fossil spores from Upper Permian records are potentially of Lycopodium affinity and indicate that early cladogenesis in Lycopodium may be even older. An evaluation of biogeographic and phylogenetic patterns in these two genera shows a striking difference from that in Huperzia. Sections within Lycopodium and Lycopodiella have broad geographic distributions, whereas molecular data partition the much larger Huperzia group into predominantly neotropical and paleotropical clades.}
}
Matrix 3682 of Study 705

Citation title:
"Relationships of Lycopodium and Lycopodiella based on combined plastid rbcL gene and trnL intron sequence data.".

This study was previously identified under the legacy study ID S546
(Status: Published).
Matrices
Title: rbcL
Description: Legacy TreeBASE Matrix ID = M804
Rows
|
Taxon Label |
Row Segments |
Characters 1?–30 |
| Lycopodiella caroliniana |
(none)
|
?????????AAGTGTTGGATTCAAGGCTGG |
| Lycopodiella lateralis |
(none)
|
?????????AAGTTCTGGATTCAAGGCTGG |
| Lycopodiella pendulina |
(none)
|
????????????????????????GGCCGG |
| Lycopodiella glaucescens |
(none)
|
?????????AAGTGTTGGATTCAAGGCCGG |
| Lycopodiella cernua |
(none)
|
?????????????????????????????? |
| Lycopodiella inundata |
(none)
|
GACTAAAACTAGTGTTGGATTCAAAGCTGG |
| Lycopodiella alopecuroides |
(none)
|
GACTAAAACTAGTGTTGGATTCAAAGCTGG |
| Lycopodium scariosum |
(none)
|
?????????????????????????????? |
| Lycopodium jussiaei |
(none)
|
?????????????????????????????? |
| Lycopodium casuarinoides |
(none)
|
??????????AGTGTTGGATTCAAAGCTGG |
| Lycopodium vestitum |
(none)
|
?????????AAGTGTTGGATTTAAAGCTGG |
| Lycopodium clavatum |
(none)
|
GACTAAAACAAGTGTTGGATTTAAAGCTGG |
| Lycopodium annotinum |
(none)
|
?????????AAGTGTTGGATTCAAAGCTGG |
| Lycopodium obscurum |
(none)
|
GACTAAAACAAGTGTTGGATTCAAAGCTGG |
| Lycopodium digitatum |
(none)
|
GACTAAAACAAGTGTTGGATTCAAAGCTGG |
| Lycopodium wightianum |
(none)
|
??????????AGTGTTGGATTCAAAGCTGG |
| Lycopodium alpinum |
(none)
|
?????????AAGTGTTGGATTCAAAGCTGG |
| Lycopodium deuterodensum |
(none)
|
?????????AAGTGTTGGATTCAAAGCTGG |
| Lycopodium volubile |
(none)
|
?????????AAGTGTTGGATTCAAAGCTGG |
| Lycopodium fastigiatum |
(none)
|
????????????????GGATTCAAAGCTGG |
| Lycopodium magellanicum |
(none)
|
?????????AAGTGTTGGATTCAAAGCTGG |
| Phylloglossum |
(none)
|
GACTAAAACAAGTGTTGGATTCAAAGCT?G |
| Huperzia campiana |
(none)
|
????AAAACAAGTGTTGGATTCAAAGCTGG |
| Huperzia hippuridea |
(none)
|
GACTAAAACAAGTGTTGGATTCAAAGCTGG |
| Huperzia selago |
(none)
|
GACTAAAACAAGTGTTGGATTCAAAGCTGG |
Columns
None of the columns has a description.